امتیاز موضوع:
  • 1 رأی - میانگین امتیازات: 4
  • 1
  • 2
  • 3
  • 4
  • 5
تست فصل اول زیست پیش دانشگاهی؛ پروتئین سازی ( سری 5)
#1
1- مونومر فعال كننده و افزاينده به ترتيب كدامند ؟

1) هر دو آمينو اسيد 2)‌ آمينو اسيد ، نوكلئوتيد 3) هر دو نوكلئوتيد 4) نوكلئوتيد ، آمينو اسيد

2- تنظيم بيان ژن در كدام جاندار ، بعد از ترجمه هم صورت مي گيرد ؟

1) هموفيلوس آنفلوآنزا 2) استرپتوكوكوس نومونيا 3) اشرشيا كلاي 4) نوروسپورا كراسا

3- هرگاه قطعه ژني در آدمي داراي 538 پيوند فسفو دي استر باشد ، رشته پلي پپتيدي كه تحت رهبري آن ساخته مي شود چند پيوند پپتيدي دارد ؟

1) 90 2) 89 3) 88 4) 87

4- كدام يك در هسته نورو گلياي آدمي داراي رمز است ؟

1) لسيتين 2) كوتين 3) كراتين 4) كيتين

5- هرگاه توالي يك رشته DNA به صورت CGTAATGCC باشد ، ملكول mRNA اي كه از روي رشته مقابل آن رونويسي مي شود داراي چند باز پوريني است ؟

1) 5 2) 4 3) 3 4) 2

6- هرگاه ظرف شيري را به باكتري اشرشيا کلای آلوده كنيم ، احتمال تشكيل كدام تركيب بيشتر است ؟

1) مهار كننده – لاكتوز 2) اپراتور – مهار كننده

3) پروتئين تنظيمي – آلولاكتوز 4) RNA پليمراز – اپراتور

7- tRNA آغازگر به ترتيب و از راست به چپ ، از كدام جايگاه وارد ريبوزوم شده و از كدام جايگاه خارج مي گردد ؟

1) P , A 2) A , P 3) A , A 4) P , P

8- عوامل رونويسي در آميب به كدام ، وصل نمي شوند ؟

1) اپراتور 2) توالي افزاينده 3) RNA پليمراز 4) راه انداز

9- در ترجمه RNA پيك مقابل ، اولين و آخرين آنتي كدوني كه درون جايگاه A ريبوزوم قرار مي گيرد به ترتيب و از راست به چپ كدامند ؟


CCUUUAAUGGCCUACGGCAUCGAUUAACCG

1) AUU , AAU 2) CUA , CGG 3) AUU , CGG 4)‌ CUA , UAC

10- تنوع محصولاتِ كدام RNA پليمراز بيشتر است ؟

1) I 2) III 3) پروكاريوتي 4) II

11- كپك نوروسپوراي غير جهش يافته قادر به ساختن كدام نمي باشد ؟

1) فنيل اُرنیتین 2) آرژینین 3) بيوتين 4) سيترولين

12- در پديده رونويسي ژن، كدام مرحله از بقیه زودتر انجام می شود؟

1) تشكيل پيوند هاي فسفودي استر 2) شكستن پيوند هاي هيدروژني

3) اتصال هليكاز به DNA الگو 4) اتصال آنزيم RNAپليمراز به دو رشته DNA


13- اگر mRNA نابالغ در نوتروفیل داراي 3 توالي رونوشت اگزون باشد ، براي كوتاه شدن آن از راست به چپ چند پيوند فسفودي استر مي شكند و تشكيل مي شود ؟

1) 4 و 2 2) 6 و 3 3) 2 و 4 4) 3 و 6

14- در انتهاي بخش رمز گردانِ ژن سازنده انواع RNA هاي ناقل کدام توالي ديده مي شود ؟

1) CCA (4 GGT(3 UAC (2 GGU

15 جهش در كدام يك به نسل بعد هم منتقل مي گردد ؟

1) كروموزم x در لوزالمعده 2) كروموزم y در كبد 3) كروموزم 21 در تخمك 4) كروموزم 23 در شبكيه

16- توالي راه انداز (P) داراي ....................... (جمله را کامل کنید)

1) ريبوز بوده و رونويسي مي شود . 2) دئوكسي ريبوز بوده و رونويسي مي شود .

3 ) ريبوز بوده و رونويسي نمي شود . 4) دئوكسي ريبوز بوده و رونويسي نمي شود .

17- كدام آنتي كدون زير را مي توان در سلول ها يافت ؟

1) AAC 2) ACU 3) AUC 4) AUU

18- براي ساخت يك رشته پلي پپتيد با n‌ آمينو اسيد ،‌ريبوزوم چند بار روي mRNA حركت مي كند ؟

1) n+1 2) n 3) n-1 4) n+2

19- RNA پليمراز III به كدام يك وصل مي شود ؟

1) DNA دو رشته اي حلقوي 2) DNA دو رشته اي خطي

3) DNA تك رشته اي خطي 4) DNA تك رشته اي حلقوي

20- كدام ، در مورد عامل پايان ترجمه درست نيست ؟

1) جنس مونومر هاي آن آمينو اسيدي است .

2) شناسايي رمز UAA را به عهده دارد .

3) در جايگاه A ريبوزوم جاي مي گيرد .

4) پيوند بين آخرين tRNA موجود در جايگاه A و پلي پپتيد را مي شكند .

21- الگو برداري از ژن سازنده آنزيمِ تجزيه كننده اسيد هموجنتيسيك به عهده كدام است ؟

1) هليكاز 2) DNA پليمراز يوكاريوتي

3) RNA پليمراز II 4) RNA پليمراز I

22- «مهار كننده» در كجا و توسط كدام ژن ساخته مي شود ؟

1) سيتوپلاسم ، تنظيمي و حلقوي 2) هسته ، ساختاري و حلقوي

3) سيتوپلاسم ، ساختاري و خطي 4) هسته ، تنظيمي و خطي

23- در بين توالي هاي اگزون و اينترون ............. (جمله را کامل کنید)

1) فقط دومي رو نويسي مي شود . 2) فقط قسمتي از رونوشت اولي ترجمه مي گردد .

3) فقط اولي رونويسي مي شود . 4) فقط قسمتي از رونوشت دومي ترجمه مي گردد .

24- تنوع مونومرهاي كدام ، بيشتر است ؟

1) اپراتور 2) افزاينده 3) عامل رونويسي 4) رونوشت اينترون

25- كدام گزينه نادرست بيان شده است ؟

1) محل برقراري پيوند پپتيدي درجايگاه A ريبوزوم است .

2) عمل دوبازوي tRNA كمك به نگهداري اين مولكول درون ريبوزوم است .

3) اتصال زير واحد بزرگ ريبوزوم در انتهاي مرحله آغاز ترجمه روي مي دهد .

4) قند پنتوز در آنتي كدون و كدون باهم متفاوت است .


26- همه مولكول هاي tRNA ................. (جمله را کامل کنید)

1) محصول فعاليت RNA پليمراز III هستند .

2) در هسته ساخته مي شوند ولي در سيتوپلاسم فعالیت دارند .

3) داراي بازوي آنتي كدونِ CCA مي باشند .

4) در نوكلئوتيد آدنين دار انتهايي به آمينواسيد متصل مي شوند .

27- توانایی انجام كدام عمل بين هليكاز و RNA پليمراز مشترك می باشد ؟

1) شكستن پيوند هاي هيدروژني 2) تشكيل پيوند هاي هيدروژني

3) شكستن پيوند هاي فسفودي استر 4) تشكيل پيوند هاي فسفودي استر


اگه جوابشو هم خواستین بگید میذارم Smile
...I dont know wat to Do... n even if i do... nothin changes
...Im Confused... Scared... So scared of the future ahead of me
!! Ya wat i have never been
!! is it my fault? well maybe ya... because im not Ordinary
پاسخ
 سپاس شده توسط نوید خزدوز


موضوعات مرتبط با این موضوع...
موضوع نویسنده پاسخ بازدید آخرین ارسال
  تست فصل دوم زیست پیش دانشگاهی؛ مهندسی ژنتیک ( سری 3) M@h$A 2 279 12-09-2013، 01:40 PM
آخرین ارسال: M@h$A
  تست فصل دوم زیست پیش دانشگاهی؛ مهندسی ژنتیک ( سری 2) M@h$A 2 370 12-09-2013، 01:39 PM
آخرین ارسال: M@h$A
  تست فصل اول زیست پیش دانشگاهی؛ پروتئین سازی ( سری 3) M@h$A 2 284 12-09-2013، 01:11 PM
آخرین ارسال: M@h$A
  روش مطالعه درس زیست شناسی ۱ و ۲ و پیش دانشگاهی M@h$A 0 178 11-09-2013، 09:05 PM
آخرین ارسال: M@h$A
  تست فصل دوم زیست پیش دانشگاهی؛ مهندسی ژنتیک ( سری 1) M@h$A 0 230 11-09-2013، 09:04 PM
آخرین ارسال: M@h$A
  تست فصل اول زیست پیش دانشگاهی؛ پروتئین سازی ( سری 4) M@h$A 0 160 11-09-2013، 09:04 PM
آخرین ارسال: M@h$A
  تست فصل اول زیست پیش دانشگاهی؛ پروتئین سازی ( سری 2) M@h$A 0 147 11-09-2013، 09:04 PM
آخرین ارسال: M@h$A
  تست فصل اول زیست پیش دانشگاهی؛ پروتئین سازی ( سری 1) M@h$A 0 212 11-09-2013، 09:04 PM
آخرین ارسال: M@h$A
  نمونه سوال + پاسخ؛ زیست پیش دانشگاهی فتوسنتز و تنفس سلولی M@h$A 0 1,771 12-12-2011، 08:15 PM
آخرین ارسال: M@h$A
  نمونه سوالات زیست شناسی فصل 5 پیش دانشگاهی M@h$A 0 3,551 12-12-2011، 08:08 PM
آخرین ارسال: M@h$A

پرش به انجمن:


کاربرانِ درحال بازدید از این موضوع: 1 مهمان